Jurnal Health Sains: pï¿½ISSN: 2723-4339 e-ISSN: 2548-1398

Vol. 3, No.12, Desember 2022

Relationship Between Esbls Production And Virulence Factors Of Fima And Papc Gene In Uropathogenic Escherichia Coli Isolation From Private Hospital

Ade Hasan Basri¹, Anang Kurniawan², Joko Setyono³, Dwi Utami Anjarwati⁴

Faculty of Medicine, Jenderal Soedirman University, Purwokerto, Central Java, Indonesia

Email:[email protected],[email protected] [email protected], [email protected]

INFO ARTIKEL

ABSTRACT

Diterima

29 November 2022

Direvisi

12 December 2022

Disetujui

25 December 2022

Escherichia coli is one of the opportunistic pathogenic that occupies the highest position causing the incidence of UTI. Fimbriae, particularly type 1 and P fimbriae, are the most commonly implicated bacterial cell surface virulence factors. The production of ESBL and virulence factors in E.coli bacteria causes chronicity, persistence, and recurrence of infections that cause high morbidity and mortality. Therefore, this study was conducted to explain the relationship between ESBL production and its virulence factors in E.coli bacteria. The design of this research is analytic observational with a cross-sectional approach was conducted from March to May 2021. A total of 40 E. coli strains were isolated and collected from urine samples of UTI patients who were admitted to the hospital. in a private Hospital in Banyumas Region in Central Java, Indonesia. The HiChrome ESBL Agar Base media was used to screen for ESBL-Producing E. coli. Identification of firmA and ppC genes was performed by using the PCR method. All urine samples diagnosed with UTI were examined for ESBL production. As many as 25% of E.coli were ESBL-production. All isolates showing positive E.coli ESBL results were then analyzed for fimA and papC genes using the PCR method. The results obtained 100% fimA gene and 80% papC gene. The conclusion is that there is a strong relationship between ESBL production with fimA and papC genes.

Keywords:

ESBL, fimA, papC, Escherichia coli, virulence factors

Introduction

Infection of the urinary tract is caused by the proliferation of bacteria in the urinary system of humans (Andersen et al., 2022). Bacteria, viruses, and fungi can cause Urinary Tract Infections. The type of bacteria that causes UTI is anaerobic Gram-negative bacteria commonly found in the digestive tract (Enterobacteriaceae) (Terlizzi et al., 2017). Escherichia coli is opportunistic pathogenic. Enterobacteriaceae bacteria occupy the highest position, causing UTI incidence (Prasetya et al., 2019). E.coli can transform from flora in the intestine to pathogens in the urinary system, where they can flourish and persist. This pathogen has various virulence factors and tactics that allow them to infect and illness the urinary tract. This strain is a uropathogenic E.coli (UPEC) because it is persistently linked to uropathogenic infections (Shah et al., 2019).

Fimbriae, especially type 1 and P fimbriae, are the most frequently implicated bacterial cell surface virulence factors (Emody et al., 2003). Fimbriae type 1 is an essential UPEC virulence factor that can stabilize bacteria's adhesion to different cell types in the urinary system (Parvez & Rahman, 2018). P fimbriae are connected to the carbohydrate complex alpha-D-Galp-(1-4)-beta-D-Galp and are pyelonephritogenic. They adhere tightly to Bowman's capsule, glomerulus, and endothelial cells that line blood channel walls in the kidney. PapC protein is the most significant protein with 80 KD, aiding this process by transporting subunits outside the cell (Wullt et al., 2000).

UTIs will be challenging to treat when experiencing antibiotic resistance problems. E.coli is one of the bacteria that can become resistant to antibiotic drugs in UTI because it can produce the Extended-Spectrum -lactamase (ESBL) enzyme, and E.coli is the highest producer of ESBL (Prasetya et al., 2019). Extended- Spectrum Beta-lactamase is an enzyme that breaks down Beta-lactams into ineffective. Beta-lactams are a class of antibiotics that work to inhibit and damage the cell walls of Gram-negative bacteria (Vickers, 2017). The production of ESBL and virulence factors in E.coli bacteria causes chronicity, persistence, and recurrence of infections that cause high morbidity and mortality (Dumaru et al., 2019). Understanding the relationship between virulence genes and ESBL production in E.coli is critical in developing successful UTI prevention and management strategies and actions, particularly for severe, recurrent, and complicated UTIs (Katongole et al., 2020). Therefore, this study was conducted to explain the relationship between ESBL production and its virulence factors in E.coli bacteria

Methods

This cross-sectional study was conducted from March to May 2021 in Central Java. E. coli isolates were isolated and collected from urine specimens of UTI patients admitted to a private Hospital in Banyumas Region in Central Java, Indonesia. The microorganisms were stored in TSB (Tryptic soy broth) containing 15% glycerol at -70ï¿½C (Fattahi et al., 2015).

Determination of ESBl-producing E. coli isolates

The screening of ESBL-producing E. coli was performed using the HiCromeTM ESBL Agar Base media. Inoculate related samples directly on the plate and incubate for 18-24 hours in aerobic conditions at 35-37 ï¿½C. Pink to purple colonies showed a positive result, namely E.coli producing ESBL (Grohs et al., 2013).

DNA extraction and PCR method

The DNA extraction kit was used to extract total genomic DNA from ten E. coli isolates. The DNA of the fimA gene in the chromosome was extracted using Presto Mini gDNA Bacteria Kit Geneid and PapC gene. DNA in Plasmid was extracted using Presto Mini Plasmid Kit Geneid according to the manufacturer's directions. Specific primers were used for amplification of the fimA and papC genes (Table 1).

Table 2.

Relationship between ESBL production with fimA and papC genes

Gene	Positive	Negative	ESBL	P values
fimA	10	0	10	0.01
papC	8	2	10	0.02

One of the most frequent bacterial illnesses is urinary tract infection (UTI), and UPEC is the culprit that causes more than half of nosocomial UTIs. The virulence factors of UPEC strains can cause an inflammatory response in UTI (Bien et al., 2012). This study aimed to determine the relationship between ESBL production and its virulence factors in E.coli bacteria. In this study, out of 40 isolated urine samples, E. coli was the highest producer of ESBL, namely 10 isolates (25%). The possible reason was E.coli has a plasmid that can encode resistance genetic mutation factors. The mechanism of ESBL resistance in E.coli is genetically inherited by new intrinsically resistant strains (Grohs et al., 2013). The results of this study are in accordance with the study of (Prasetya et al., 2019) in East Java, which explained that E.coli is one of the opportunistic pathogenic Enterobacteriaceae bacteria that occupy the highest position causing the incidence of UTIs and is the highest ESBLproducing bacteria. The results of a study conducted by (Shrestha et al., 2019) in Nepal showed the same results, namely E.coli, which was positive for ESBL more than 20% of the total sample examined

The fimA and papC genes appeared in isolate E. coli ESBL. The result indicates that fimA and papC genes can occur in all E.coli strains (Bien et al., 2012). fimA is the most abundant protein produced by type 1 fimbriae and functions at the time of adhesin (Parvez & Rahman, 2018). PapC genes were detected to be associated with pyelonephritis and were found in 60% of E.coli strains. The ability to colonize the urinary tract epithelium is known to be linked to the presence of this gene. The papC gene produces an outer membrane protein that regulates the development of P fimbriae (Winberg, 1984). Most infections caused by E.coli are closely related to virulence factors with the pathogenicity of E.coli in urinary tract infections. Several essential virulent genes of the UPEC strain which is associated with severe urinary tract infections are afimbrial adhesin (afal), hemolysin (HLY), cytotoxic necrotizing factor (cnf 1), aerobactin (aer), S fimbriae (sfa), P fimbriae (pap), type 1 fimbriae (fimA) (Winberg, 1984).

The results of this study indicate that there is a strong relationship between ESBL production and the virulence factors of the fimA and papC genes. These results are consistent with the study of (Shah et al., 2019), which explains that there is a significant relationship between virulence factors and ESBL resistance.

In the urinary system, virulence factors play several roles in the development and colonization process (Winberg, 1984). The ability to colonize depends on the expression of other fimbrial adhesins. The virulence factors involved in the Adhesin process are type 1 fimbriae which are essential during the attachment process (Emody et al., 2003). They produce erythrocyte hemagglutination when they enter the urinary system and cause bacteriuria. They also enable bacteria to overcome the epithelial barrier to enter the circulation (Connell et al., 1996). For entry into urinary tract host cells, type 1 fimbriae play a significant role. Fimbriae type 1 is a highly versatile UPEC virulence factor that can stabilize bacterial attachment to various cell types throughout the urinary tract (Al-Amiery et al., 2016). UPEC strain 99% can encode genes present in type 1 fimbriae (Vigil et al., 2011), consisting mainly of the protein FimA along with FimF, FimG, and FimH (Klemm & Schembri, 2000). Another virulence factor is P fimbriae, which E. coli expresses. They produce erythrocyte hemagglutination when they enter the urinary system and cause bacteriuria. They also enable bacteria to overcome the epithelial barrier to enter the circulation (Riegman et al., 1988). This type of fimbriae is encoded by the pap gene (Wullt et al., 2000). The pap gene cluster contains at least nine genes, each with two restriction sites on each end. Another papC protein, the largest at 80 KD, assists in this process by transporting subunits outside the cell (Collinson et al., 1992).

ESBL production is a common resistance mechanism of UPEC (Talbot et al., 2006). UTIs caused by ESBL-producing E.coli are becoming more widespread, and ESBL-producing E.coli are found in various Asian nations (Heffernan et al., 2009). Multidrug resistance makes selecting an antibiotic agent difficult. There is a growing link between the creation of ESBLs and multidrug resistance. The emergence of multidrug-resistant UPEC poses a serious threat to managing UTIs as medical costs increase (Neupane et al., 2016). UPEC strains that acquire potential virulence factors can improve their ability to adapt to novel environments, colonize and invade host tissues, elude immune responses, and collect resources from the host (Kï¿½hler & Dobrindt, 2011).

Conclusions

The conclusion of this study is that a strong association between ESBL production and the virulence factors of the fimA and papC genes. These findings will undoubtedly aid in understanding the pathogenicity of UTIs and their effective management, thereby reducing the inappropriate use of antibiotics. Therefore, increased physician vigilance and increased testing with Laboratory tests are needed to reduce treatment failure and prevent the spread of ESBL-producing E.coli.

References

Al-Amiery, A. A., Binti Kassim, F. A., Kadhum, A. A. H., & Mohamad, A. B. (2016). Synthesis and characterization of a novel eco-friendly corrosion inhibition for mild steel in 1 M hydrochloric acid. Scientific Reports, 6(1), 1ï¿½13.Google Scholar

Andersen, S., Nawrocki, A., Johansen, A. E., Herrero-Fresno, A., Menï¿½ndez, V. G., Mï¿½ller-Jensen, J., & Olsen, J. E. (2022). Proteomes of Uropathogenic Escherichia coli Growing in Human Urine and in J82 Urinary Bladder Cells. Proteomes, 10(2), 15. Google Scholar

Bien, J., Sokolova, O., & Bozko, P. (2012). Role of uropathogenic Escherichia coli virulence factors in development of urinary tract infection and kidney damage. International Journal of Nephrology, 2012. Google Scholar

Collinson, S. K., Emï¿½dy, L., Trust, T. J., & Kay, W. W. (1992). Thin aggregative fimbriae from diarrheagenic Escherichia coli. Journal of Bacteriology, 174(13), 4490ï¿½4495. Google Scholar

Connell, I., Agace, W., Klemm, P., Schembri, M., Mărild, S., & Svanborg, C. (1996). Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract. Proceedings of the National Academy of Sciences, 93(18), 9827ï¿½9832. Google Scholar

Dumaru, R., Baral, R., & Shrestha, L. B. (2019). Study of biofilm formation and antibiotic resistance pattern of gram-negative Bacilli among the clinical isolates at BPKIHS, Dharan. BMC Research Notes, 12(1), 1ï¿½6. Google Scholar

Emody, L., Kerenyi, M., & Nagy, G. (2003). Virulence factors of uropathogenic Escherichia coli. International Journal of Antimicrobial Agents, 22, 29ï¿½33. Google Scholar

Fattahi, S., Kafil, H. S., Nahai, M. R., Asgharzadeh, M., Nori, R., & Aghazadeh, M. (2015). Relationship of biofilm formation and different virulence genes in uropathogenic Escherichia coli isolates from Northwest Iran. GMS Hygiene and Infection Control, 10. Google Scholar

Grohs, P., Tillecovidin, B., Caumont-Prim, A., Carbonnelle, E., Day, N., Podglajen, I., & Gutmann, L. (2013). Comparison of five media for detection of extended-spectrum Beta-lactamase by use of the wasp instrument for automated specimen processing. Journal of Clinical Microbiology, 51(8), 2713ï¿½2716. Google Scholar

Heffernan, H. M., Woodhouse, R. E., Pope, C. E., & Blackmore, T. K. (2009). Prevalence and types of extended-spectrum β-lactamases among urinary Escherichia coli and Klebsiella spp. in New Zealand. International Journal of Antimicrobial Agents, 34(6), 544ï¿½549. Google Scholar

Katongole, P., Nalubega, F., Florence, N. C., Asiimwe, B., & Andia, I. (2020). Biofilm formation, antimicrobial susceptibility and virulence genes of Uropathogenic Escherichia coli isolated from clinical isolates in Uganda. BMC Infectious Diseases, 20(1), 1ï¿½6. Google Scholar

Klemm, P., & Schembri, M. A. (2000). Bacterial adhesins: function and structure. International Journal of Medical Microbiology, 290(1), 27ï¿½35. Google Scholar

Kï¿½hler, C.-D., & Dobrindt, U. (2011). What defines extraintestinal pathogenic Escherichia coli? International Journal of Medical Microbiology, 301(8), 642ï¿½647. Google Scholar

Neupane, S., Pant, N. D., Khatiwada, S., Chaudhary, R., & Banjara, M. R. (2016). Correlation between biofilm formation and resistance toward different commonly used antibiotics along with extended spectrum beta lactamase production in uropathogenic Escherichia coli isolated from the patients suspected of urinary tract infections visiting Shree Birendra Hospital, Chhauni, Kathmandu, Nepal. Antimicrobial Resistance and Infection Control, 5(1), 1ï¿½5. Google Scholar

Parvez, S. A., & Rahman, D. (2018). Virulence Factors of Uropathogenic E. coli. Microbiology of Urinary Tract Infections-Microbial Agents and Predisposing Factors, 7ï¿½21. Google Scholar

Prasetya, Y. A., Nisya, K., & Amanda, E. R. (2019). Aktivitas Nanoemulsi Minyak Lengkuas (Alpinia galanga [L] Willd) Dalam Menghambat Bakteri Escherichia coli Penghasil Extended Spectrum Beta Lactamases (ESBLs). Google Scholar

Riegman, N., Van Die, I., Leunissen, J., Hoekstra, W., & Bergmans, H. (1988). Biogenesis of F71 and F72 fimbriae of uropathogenic Escherichia coli: influence of the FsoF and FstFG proteins and localization of the Fso/FstE protein. Molecular Microbiology, 2(1), 73ï¿½80. Google Scholar

Shah, C., Baral, R., Bartaula, B., & Shrestha, L. B. (2019). Virulence factors of uropathogenic Escherichia coli (UPEC) and correlation with antimicrobial resistance. BMC Microbiology, 19(1), 1ï¿½6. Google Scholar

Shrestha, R., Khanal, S., Poudel, P., Khadayat, K., Ghaju, S., Bhandari, A., Lekhak, S., Pant, N. D., Sharma, M., & Marasini, B. P. (2019). Extended spectrum β-lactamase producing uropathogenic Escherichia coli and the correlation of biofilm with antibiotics resistance in Nepal. Annals of Clinical Microbiology and Antimicrobials, 18(1), 1ï¿½6. Google Scholar

Talbot, G. H., Bradley, J., Edwards Jr, J. E., Gilbert, D., Scheld, M., & Bartlett, J. G. (2006). Bad bugs need drugs: an update on the development pipeline from the Antimicrobial Availability Task Force of the Infectious Diseases Society of America. Clinical Infectious Diseases, 42(5), 657ï¿½668. Google Scholar

Terlizzi, M. E., Gribaudo, G., & Maffei, M. E. (2017). UroPathogenic Escherichia coli (UPEC) infections: virulence factors, bladder responses, antibiotic, and non-antibiotic antimicrobial strategies. Frontiers in Microbiology, 8, 1566. Google Scholar

Vickers, N. J. (2017). Animal communication: when iï¿½m calling you, will you answer too? Current Biology, 27(14), R713ï¿½R715. Google Scholar

Vigil, P. D., Alteri, C. J., & Mobley, H. L. T. (2011). Identification of in vivo-induced antigens including an RTX family exoprotein required for uropathogenic Escherichia coli virulence. Infection and Immunity, 79(6), 2335ï¿½2344. Google Scholar

Winberg, J. (1984). P-fimbriae, bacterial adhesion, and pyelonephritis. Archives of Disease in Childhood, 59(2), 180. Google Scholar

Wullt, B., Bergsten, G., Connell, H., Rï¿½llano, P., Gebretsadik, N., Hull, R., & Svanborg, C. (2000). P fimbriae enhance the early establishment of Escherichia coli in the human urinary tract. Molecular Microbiology, 38(3), 456ï¿½464. Google Scholar

Zamani, H., & Salehzadeh, A. (2018). Biofilm formation in uropathogenic Escherichia coli: Association with adhesion factor genes. Turkish Journal of Medical Sciences, 48(1), 162ï¿½167. https://doi.org/10.3906/sag-1707-3 Google Scholar

Gene	Primers (5'-3')	Size of product (bp)
fimA	F:GTTGTTCTGTCGGCTCTGTC	400
	R:ATGGTGTTGGTTCCGTTATCC
papC	F:GACGGCACTGCTGCAGGGTGTGGCG	328
	R:ATATCCTTTCTGCAGGGATGCAATA